CcruzaQ_5


Sequence

>CcruzaQ_5 (4 EST) Length=677 ATAAAATTTTTTTTTAAAAATCAAACAAGNTAGGGAAAAGGGGTAACCCCAGAGGAAGTNAATGGCTTAAGTTTTTTTTN TAATATATATATATATATATATATATATATATATTCTGTGGAAAACTACTCACGTGGTCTTTTGTACTCAGATCTGAAAT ATTATTACTTACGAAGTGGCAGACTTTGGGGTCCTCCAACCACAAGACCCCGCCGCGAGGTGGGAATCGAGGGGCTGGGT GGAATGGCAAAATAAAAATAAAAAATTATCTGGCCTCTATCGGTTCCCCAACCCTTAAAGTCGTTTTCTTCCCAAAAATT CATACGGTAGAAAAGTACCATAAAGAAATGTACTCGATCTATCAGGATATACACATTAAGTTAGCCAGCTCTCCCGCGAT CATTCTCTTCACAAGCCCCTACAACAGTTGGGAGAGAGGCAGTAGAAAACGAAAAAACAACAAACCAATCCTATTCTATA GGGCTACGTGTGGGTCACCGTGGCTCAGCGACGACGGCCACCCAGGTGCATCTACCATGTTGCGCCCCCTCCCTGCGCCT GNCTGAAGGCCGCTCTAAGCGCTGGCGTCGCCCTCGCCTTCTTGCTGCTCTTGTGCTTCTTCGCCAGCGCCTTGTTCAGG CTCGGCATCACACCACCACGCGACAGCGTCACATCCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, Processing,


Cluster Information for CcruzaQ_5: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6787011542841D87322D87322Trypanosoma cruzi Y (Tomoo Tanaka)
17656343244252AI026426TENU0637T. cruzi epimastigote normalized cDNA Library
18058163366473AI066308TENU2424T. cruzi epimastigote normalized cDNA Library
18416093421652AI083229TENU3907T. cruzi epimastigote normalized cDNA Library


Date: 11:4:32 on Tue 21 Nov 117.