CcruzaQ_524


Sequence

>CcruzaQ_524 (6 EST) Length=727 GCAAAGATCGAGAATATGAGGGCTGTTGATTTAATTATTTTACTTATTTCCCTTCATTCCCCGACCCTTCCCTTTTTTTT TTCCTTTTTTTTTTTTTTTTAATAAGAGGCAGTCAGTTCTTTTCCTGTCCCCCACAAGGGGTAAACAGAGAAGAGACATC CCCTCGCCCAGGAACGTAGACGCGTTGTACTTAAAAGTGAGCTTGTTTCTGAACTGAACGACCCATTGCCGAACTGGCCA GCAAGCCTTCAAAGGGCAGTGCTTACTTCACAGGGCACGCACGGCTGGTGTGGCCTGTCTGACCGCAATTGTAGCATGCG CGCTCGCTCCGGGCGGTGCGTTGGGGCAGTCGCGCGCAAGATGACCTTCCTGCTGGCAGTGATAACACGCCCCACGTGCG ACACCACGAAAGCCACCGGCTGGGCGGTTAGGGCATTCGCGGCTAAGGTGACCCATACGACCGCAATTGTAGCACGCACG GTCGCCCATGACACCAGGTGGCCTTGTGGGACATTCACGGCTGAGGTGGCCCATACGACCACAATTGTAGCACGCACGGT CGCCCATTGACACCAGGAGGCCGTGTGGGGCATTCACGGCTGAGGTGGCCCGGCTGGCCACAGTTGTAGCACGCGCGGCT TCCTCTTGTCATCGCATTGTCGGCCATGGCTGTGGAAGTTGAATGGAGAATCGTTCGGTGAATCAAGCTCAACATAGTAC AGAAACT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CcruzaQ_524: (6 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10709492107893AA426656TEUF0116T.cruzi epimastigote non-normalized cDNA Library
10709772107921AA426684TEUF0283T.cruzi epimastigote non-normalized cDNA Library
16063192988497AA879387TENU0253T.cruzi epimastigote normalized cDNA Library
16970563127228AA960730TENS1943T. cruzi epimastigote normalized cDNA Library
17973753331790AI057924TENU2016T. cruzi epimastigote normalized cDNA Library
18318203411354AI077277TENU3191T. cruzi epimastigote normalized cDNA Library


Date: 12:35:47 on Tue 21 Nov 117.