CcruzaQ_546


Sequence

>CcruzaQ_546 (6 EST) Length=544 GCGCGAGTACAGCAACACGGACACCCGCACGGTTCTGCGCCGTACTTCTTCCAGCACTACGTACCCGCCGGCTACACGAC GTTCTGGTGCCGCTACAAGTACAACGAGGACAACAAGATGCAGTTCATGACGGCCAACCTGATCCGCGGGTGGTTCCAGC GCATGGAGCACGTGCGCAAGTACGCGTTTGGCGTTGCACTCATCATTGGGGAGGAGAGGCGGCACGACATTGTGGCGCTG TGGGTGTTATTCGGCACGAGGGCATGCCGGCGATTGTGGAGGACGTGGAGGACACGGAGCTGTTCGACTGGGAGGAGGTC GCTGACGTCGCGGCGCAGCGGGAGCGCATCACGGACTACCTGTGCTGGGAGGGCCCGACGATCCCGAGGCCTGTGCTGGA GGGGCGTGTGTTCAAGTGAGCGTGGCGTGCTGGTGAGGGACTGAGTAGAGAGAATAACGGTAATAGTAACTGTGGGAGTG TGAGGAACGGGGCAAGGGCGAGGAGCACTTCTNTTTTTTTTGTCTTTTGTTTGTTGTTGTTTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CcruzaQ_546: (6 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10709902107934AA426697TEUF0078T.cruzi epimastigote non-normalized cDNA Library
16096262991775AA882664TENS0237T. cruzi epimastigote normalized cDNA Library
16943803123956AA958249TENS1532T. cruzi epimastigote normalized cDNA Library
17854583293964AI046066TENU1102T. cruzi epimastigote normalized cDNA Library
18047713340723AI065316TENU2203T. cruzi epimastigote normalized cDNA Library
18058363366493AI066328TENU2444T. cruzi epimastigote normalized cDNA Library


Date: 11:53:42 on Wed 22 Nov 117.