CcruzaQ_553


Sequence

>CcruzaQ_553 (2 EST) Length=750 CATCGCTCCCCGCCCTTTGCCAGAGCGTGACCCTTTAAATAGCACGGGTGTCACAAAAATTTTCTCACCATCTTCTGTGC AATCCATGCGGAGGAGTTCCACTTCTCGCCCGAGAGTTCCAGAGCGTAACGGGGTTTTCCTGGACATGTATGCCATTATC CGTCAGTTTATGGTCTTCGTCAGGAGCTGATTTCTTTTAGAGGGGACGTTGGATCGGACAGCGTCTTGGATGTGGAGGAC CCGTGGTTTGACGCCATTGAGGCTGCCTCAGAAGAGGCGGAGGCGCAAACGGCATACGCACTGAAGCTTGCTGTTTTTAA ATTTGCGTTGGTCCCTTTTTTGGAGAGTCTCCTGGCAACAGCGGAGGGGGTGCTGCCGTACATCCGTGAGTCTCCCGTCA CCGAGGAGGTGCGATCGATGCTTCGGGGCTGTTTGCTCTGCGTGGATTACCTGTATGCGGATGCGGAGGATCTTACGTCA ACGGCCGCAACGAGACGGAGCGGCAGAGCCTCTACGGGTTCCCACCTTTCTAAAAATGGACGGGCAAGTCTTTTGCTTGA CATAACGACACGACGGGAGCAGGAGATGCGGCAACTCTTCGATGATGCCATGGAACAACGTANGTTCCAGAACTCGATCG AGTCCATAGCCGCACAGCGTGACACCATTGCAGAGTTTTTGCGTGTCTGCTCTGGACAATAATTTATTTGTACGGAAGCA ACTGANGGGGTGAAGAAAGANGGAGTGGGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CcruzaQ_553: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11767922275728AA532196TENF0325T.cruzi epimastigote normalized cDNA Library
18318993411433AI077125TENU3273T. cruzi epimastigote normalized cDNA Library


Date: 11:23:24 on Sun 19 Nov 117.