CcruzaQ_555


Sequence

>CcruzaQ_555 (2 EST) Length=688 GAGAACCAGAAGCATCATATTCTCCAAAATCTAACAACCAAAAACAAAATAAATAAATAANATCAAGACAAGTAAAATAA CACTACGAATTCCCCGCCCTCGCCCTTCCTTCTTTTCCCCCCTATTAAGATGCATCTGTTAATGGATTTGAATGTCTATA GAATTTATGCGCCTCGTGGTTTATTACAGCGCTTTTACCAGCTTTGGTCTTCTTCGTATTCCCCCGCTTCCTTCCTGCCC TTCTCCCTTCCCCACTTTTCTCTTTCTCCCTCTCACTTATGCATATATACCCCCATATGCATGTATGTATTCATTCACAC CCATGCATACATCGGCTGGTATGCATTGCGCTAGTTTTTCTTCGATGTTTCAGATTTAATGGTAAGGAGTTTAATGATGC CTTTCATGGAATACAGCATCCGTCCGAAGATAACTTGCGATAGGGACCCCATGAAGGAAAAGGCAGCATCTGTGATTGGG TACTGGAGAATGGGCGGTATGGTCGTCTTCACACCGGGGATGCGGTCAGTCGTTGAGGCCCTAACGATGCAGTTCCCACG GAGACCTTCCATGCCGGCAAATCGATCAAACCCGCTGATCCCCACTCCACCGAACGGCAACGACTGGCAGAGGTAGTTAA TGCAAAAATCGTTTACGTTTGTCATCCCTGTCCTCAATTTGGCCCCAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CcruzaQ_555: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17854303293936AI046038TENU1074T. cruzi epimastigote normalized cDNA Library
18688473482854AI110318TENU3314T. cruzi epimastigote normalized cDNA Library


Date: 21:5:31 on Fri 24 Nov 117.