CcruzaQ_567


Sequence

>CcruzaQ_567 (2 EST) Length=756 GAAGAGGTCGGGGTTCGTAACAGCTTTGAAAAGCTGTCCTAGTGCGTGCAGGTGTTGCAGCTATTGTAGCGATACAAGGC TGACGGCTGCGTTATCGGCACAAGGAAACAGTATTGAGAAGGAAAGGTGTAGTTTTACGCATATATTGATTGCGAGAGGG TACACACCACATACCTGAAAGGTAAAAAAGGAGTCAATAAATAAACAGAAATAAATAAGAAGCAATTTTTGTAGCCAATC TTTTTATTTTTATTCACTTGTGTGTGCGTGTGTGTTTGTTTTAATTACTGTTCCTTAATGCGTGTCACGTAGGATTATCG GCGTCACTCGTTTATTACTTTTTGTGATTTGTGTTTAATTCATCATTTTGTTTATTGTGGCTTTTGAGGGCGAATTGTTA CGACACGTGCTTATCATTATTACGGAGTGCACATATAAGGAAAGGGTGGCCCCTTTTTCGCAGTCGTGTACGCAGCGGGT GAGTAGGAGAGAGAGAGAGAAAGAGAAAGACTGATAAAACATTACGGGCACCAAANAGTGCCATTTGAGGAGGACCANCG CNAACAATAAGAGAGAANAAGGGAGGANGGTTTGGCCGCCCTGTTCCTTTAATTTTTGTCTGCTTGTTTGTGTCCGTGTG TGTGTGTGTGTGTGGTCCANTGATATTTGTTTAAATTGGCACACGTCACGTTGCTGCTTTACACNGCGGGTTGAAGAAGA AACATGCCCCTAAGGGACCAANGGCNCNCCNAAAGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CcruzaQ_567: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16580723073591AA926455TENS1077T. cruzi epimastigote normalized cDNA Library
18245163392754AI069779TENU2850T. cruzi epimastigote normalized cDNA Library


Date: 5:52:42 on Sun 19 Nov 117.