CcruzaQ_572


Sequence

>CcruzaQ_572 (2 EST) Length=784 TCTTCAAGGGGTTTAAGTTGGGTACGCCAGGGTTTTCCCAGTTCACGACGTTTTAAAACGACGGCCAGTGCCAAGCTTAA ATTTACCCTCACTAAAGGGAATAAGCTTGCGGCCGCAACTTTTTTTTTTTTTTTTTTTTTTTTTCAGGAACAAGAAGATG GGCAATCCACTACGGAAGTGACTGAAAACACGAACACTAACACGTCAAATGAACAAAAGAAGGCCGCCGCACCAACTACG ACCACGACGACCACGACGACCACTACAACAACGACGACGACCACCACCACCACCGAGGCACCAATTACGACTACAGAGGC ACCAACCACGACGACCACCCACGCACCGTCACTTCTTCGCGAAATCGACGGCAGCCTCAGCAGCTCTGCGTGGGTGTGTA CCCCGCTGCTGCTCGCCGTATCCGCGCTGGCGTACACCACTCTGGGCTGAAGAGGTGTATGCGGGCTGTGCGTGCCAGCA CTCTAGCCACGGGGACATTTGTGAGTCTACCGTGGTCCGATGTATAAAGTAAGAGTAATTATGATGATTGTGTTTTGCTT TGCTTGCTTCTGCTGCCATGCTGTGTGCTCCGCGTTGTGCACCACATCCGTCACGTTGAACGCATCCCAGACACACCCAT ATGCATGCGCACTGGAGCCTTAGGTTTGTTTTTTCTTGTTTTTTAATTCTTTTCTTAATTCTTTTTTTAATTCTTTTTTT CGTTGCTTCTGCTTTTATAGCTTCTGTGTTGTGGGGCGGTGTGCGAGTTCTGCAATTGTACTGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, Processing,


Cluster Information for CcruzaQ_572: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13817192655797AA676133TENF0684T.cruzi epimastigote normalized cDNA Library
14534872772476AA738515TENU0024T.cruzi epimastigote normalized cDNA Library


Date: 6:11:54 on Fri 24 Nov 117.