CcruzaQ_6


Sequence

>CcruzaQ_6 (2 EST) Length=641 CTTTGCGTCAAGAAAAGGGTGTTGACGCATTCCTGACCACCCTCGTGCAGAAGAGCACGACGTTTCACACAAAGACGGCA TACTCGCAAGAGAAGTATCTTCGAAAAAAAAAGAAGCGTTACGGTACATTATACAAGGTGGAACGCGTGACACCTGACGC CGCCGCAGAGATTTATCTCCCGACAATCAACCCATCGGATGTGGAACCGGAGGAAACACGGTCAATGCGGCTTCGCGCTG ACACTTTGGCGCTTATTTTGCACCACAGTGATGTACATAGTGGTAGTCGTGTTCTCGTGTACGAAAAAACAAATGGCCAC TTGGCAGCAGCACTGCTCACACGTCTTGGGAACGACGGTGTAATAATGCAAGTGATGGATAAGGTTGCACAGCCCAACGT GGTTTTCTGGGCGCAGGGCGATTGGGCCTCACTCGCCGTGCGGGAACTTTTGGAAAGCCATCCCTTCGAAATGATGGCTT TCCTTCTTGGCAGGGATGGTCCAGAAGTGAGGACAGAATCCCGGGAGACCGAGATGAAGAAGCAGGCACTGGGAAAACAC NCCATTAAGGACCATGGAAAGAGGATGTGGTTTAAGCCACGATGGTACTGGTTCCCCTATTTAAGAAGCGGCGGCCCCTT T


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CcruzaQ_6: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13816742655752AA676088TENF0620T.cruzi epimastigote normalized cDNA Library
13816772655755AA676091TENF0623T.cruzi epimastigote normalized cDNA Library


Date: 16:16:3 on Mon 20 Nov 117.