CcruzaQ_604


Sequence

>CcruzaQ_604 (6 EST) Length=517 GCCCCAACAGGAATGTGTCCTTCCCTGTCGGCGCCACCATTGCGAACTGGTCAAACGTCAGGCACTCACCACCGGCGCCG GTGATGCGTTCGCGGGCGCTCTTTGAAAACCGAAGGGCGCACACACGCAAAGCGGGGATGCGGGTCATGCGGACGTCATC AAGCACATCACCGACAATGACGGCAATGGGGGCCTTCTTGCCCTTCTCCAGCCACACCGACTTGCGCTTCATGCAGACGG CGATGCGGCTCAGAGAGATTGGGGCACGGTTGCTGCGGCTCTTAAGCAGGCGCTGGTGCACGAGCTTGTTGAATGCGGAG TTGGTGCGTTGGGCGAGGAACTTGTAGAGCTTAATGAGCAGTTTGATGTACGGGTTCGTCGAATAAGTGTGGTGGCGCAC CACGCGCTTCTTCTTCTGGACTCCGGTGAGGTCGACTCCCATTTCTTCCGCAATGCCAAATGANNGAAAAGNNNNAAANN CANAGCAATATAGTACAGAAACTCCTCGTGCCGAATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CcruzaQ_604: (6 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10410782053309AA399708TEUF0013T.cruzi epimastigote non-normalized cDNA Library
10709552107899AA426662TEUF0155T.cruzi epimastigote non-normalized cDNA Library
12064082327487AA556035TENF0070T.cruzi epimastigote normalized cDNA Library
16020482981535AA875705TENU0176T.cruzi epimastigote normalized cDNA Library
16944783124054AA958097TENS1630T. cruzi epimastigote normalized cDNA Library
17926223320958AI053331TENU1491T. cruzi epimastigote normalized cDNA Library


Date: 23:32:52 on Fri 17 Nov 117.