CcruzaQ_605


Sequence

>CcruzaQ_605 (2 EST) Length=510 CAGCATGCAACCCATGGGTTCCCCTCAAATCCACCCGCATCCTAATTTTACCGACAAAACCGCCTCTTCTGTTTGCTGTT GTGGCTGCTGTCATTTCATCGTCGTAAAAGCAACCTTTACGACAGACCCAAGTCAAAAAGTATCCATCCACTGCTCTTCC ACATGACGCACGGTCCATGTGTAAACGTATTTATAAAATTCTTCTTCAAATTTTCCGCTACTTTTGTGTCGACCCCCTCC CCTCCGCTCTGCTCTGCTCTTCGTTCATGTCTATCGTCAAAGAAGTGTGTCCCCGCGCACAGTGATGGATCCAAATTTGG GGTAAGGCCCTGTTGCACCGGGCGTCTTCACCATAAGCCACATGAAGTAGGAGGAGATGCCTCCAAAAAGATGCCACATG CCGTGATATATGCGGCATGGATCTTCCGTATCGTTTAGTCCGACAATAAAAAACGGAACGGCGAGGCACATAAATATAGC AGCAATGATAAATTGACGATACTCAATCGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CcruzaQ_605: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17855913294097AI046199TENU1286T. cruzi epimastigote normalized cDNA Library
18244093392647AI069672TENU2716T. cruzi epimastigote normalized cDNA Library


Date: 2:42:54 on Mon 20 Nov 117.