CcruzaQ_61


Sequence

>CcruzaQ_61 (2 EST) Length=615 ATCCCGGCAGTACTCCGAGTCTTTTCCGGGTAAACAACTCTTCTTTACAGCCCCTCCGCCCTCGCCACTGGAATCCGGAA AAACCGACGCTCAAACGCCTGCAACGGCAGAGGAGACGGCTGCAATTGCGTCCAAAAAGGAAAACTACATGACTTTCTCT CCCCGTCTGACTATTAATAAGGATGGAACGGGATTTGGAAAGGTCAAGCTTGGGTGCGGCCTCTGTATTCAACGTGTTTG TCGCTTTGAGCAGGGTTTGACGTTAACCAGCAGGGGAGTTGTTGCTACCAACGTAAAATTGATTGATCTTCTTGAAGGCC TCGAACTTAAGGGTCGGGTTTCCGTTAATACGATTGCCCCCGCATCGGAGGATGTGTCGGTGGCTACTATAGATTATCAA AGGCGTGATTTTTACACTACACTCGGCTACCAACGCAATGGACTTGGCAGTAGTGATCTCTTGGTGGATTGCGGAACGAA ATTCTTTAATCTTCTCGTTGGTGCGGGCTTTGAAAGGCAAAAACTGTCCTACCTTGAGCATCACGATGCCTCAGCGCAGA TGGATGTGCTATATGCAGGTTTAGGCTTCACTGGGGTCAACTGGTCGATTGGTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CcruzaQ_61: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17971743331589AI057723TENU1813T. cruzi epimastigote normalized cDNA Library
18047233340675AI065268TENU2155T. cruzi epimastigote normalized cDNA Library


Date: 0:48:59 on Fri 24 Nov 117.