CcruzaQ_618


Sequence

>CcruzaQ_618 (2 EST) Length=509 ACCCCCGGTTTCAAAAGGCCACCAAGGTGTTAAGGCCCGGAACGACGAATAATGGGCATTAAAAACGGGCAATTCGATCC GCAATTCGAAAGGCCTTTCTCCCTCAAAAAGATGATTCTGTGAGTTAATGGGGAGGCGATGCATGTCGTTGCATGCTCAA AAAGCTCCCATGCACCAGCAGCAATGACAGCTTCCACTTCCCCCTCCTTCTCTTCGTCCTCTGTTCTATTTGCAAAGTTT TGATTGTCTGCTGCAGCCGAAGGTCCGACTTCGGGGGGCTCAAGTCCTGAAAGTGCATGCCACAGCATCGCCCATAGTGT CTCCTCGCCCTCCAGCATGGCGCCTCGAAGAGCTTCGTCATGGGGAGAAAACTTTGCAAGAACGGCCATCATTTTTGCAT GTACGGTGATGCGTCTTGTTGACTTCCCCTCGGCAACCACCTGTTCACGTAGTGTACGCCAGGTATGCAGTGAAAACGAA AAATCTCCGCTGCTGCTCCGGGTCCGTGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CcruzaQ_618: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13816932655771AA676107TENF0652T.cruzi epimastigote normalized cDNA Library
13816942655772AA676108TENF0653T.cruzi epimastigote normalized cDNA Library


Date: 15:6:54 on Wed 22 Nov 117.