CcruzaQ_666


Sequence

>CcruzaQ_666 (2 EST) Length=488 GGCACGAGGCGACAGGGAATAAATCAGGAAAGAAGAAGAGAGAAAAAAAANAGGGGGAAAGTTCTGGTGGACGAAAGAAA CGGGGCCTGCACAAGTTCGGCAAGCAGGGTTATCTAAAAATGTGGACTACTTTGATGGGCTTCGCACATTCCCTCGTGAT GCCAATGCGCTGCGTCACCACAGCGCTCGCCTGAACTACACGCTGCAGAAACGGTACAACATCCCGTCGGAGGTGGCAGA TTTGGCGCTCCAGCCACAGAACACGGAGGATTTTGATCATTACTACCGAAAGCAGGTGATGCGCATAATGGCTCACTTCA ACGCGATGACACAGAGACAAGTAAAGGTGAAGGTGGATCCTCGTTTGCCGAGGGGGATGCAGATAATCCGCGGCACAAAT GCGACTGTGCCANCAAAGTCTGGGAAGACGGAGAAGACGATGTCAGACTGGCGTGCTGCTGCCGATCCCGTCGCAAAGTA ACAAGCGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CcruzaQ_666: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11767582275694AA532162TENF0262T.cruzi epimastigote normalized cDNA Library
16888393115609AA952513TENS1448T. cruzi epimastigote normalized cDNA Library


Date: 18:35:9 on Sat 18 Nov 117.