CcruzaQ_67


Sequence

>CcruzaQ_67 (2 EST) Length=573 GTTTATTGTGCCATAAGTAAAGGAGGAAAAAGAAAAGAACGCTGGTGGCGTGCAACTTCCGCCACTTCAAGCCTTTTTGC TCAAATGTGTTGAGGCAACGGGAAATTTTCACCCGCCATTGCTATTGGGCACGCCACACGGAAACAAACAAGCAACGCAA AGTTACCAATGAAGCCATTCGAGCCGGTGCTTCCACGGAGGAGTTATTGCCGAGAAAACGGGTTGCATCAACGAAATTGG GTAAATCACCCATGCTAAACCCGATTTTAACAAAAGCCGTACGGAGTTTACCCAATTCGAAAACTGCCCTCACGTAGAGG GATTTAGTAGATGAAATTCCAAAGACCCTGCTGTGTGATAAAGATGTCCATGGGATTTGCGTAGATGTGCCAATTTTTTC CCCCTTTCGGTAGAGGGGAGTTCTTTATTTACCCCATCATTGACATTTCGATTTTGTGAAAAGAATGATTGCGAGAGGGC TGGCCACCCAATTTAATATGCACATCCTGATAAGACGAAAACATTTATTTACAATTATTTTCTCTCTTACGGTTCATTTG TAAGACTGCAATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CcruzaQ_67: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17973723331787AI057921TENU2013T. cruzi epimastigote normalized cDNA Library
18415043421547AI083124TENU3801T. cruzi epimastigote normalized cDNA Library


Date: 4:40:7 on Wed 22 Nov 117.