CcruzaQ_678


Sequence

>CcruzaQ_678 (5 EST) Length=777 TATATTGTTCGTTCTAGCTAGGCTTTCGAGCTTCTCTTCAAACACCCTCAAATAAACTCCTTCTTTTCAAGATGCGTGAG GCGATTTGCATTCACATCGGTCAGGCCGGTTGCCAGGTTGGCAATGCGTGCTGGGAGCTGTTCTGTCTGGAGCACGGTAT CCAGCCCGACGGTGCGATGCCGTCCGACAAGACGATTGGTGTGGAGGACGACGCGTTCAACACGTTCTTCTCGGAGACCG GCGCTGGCAAGCACGTGCCGCGCGCGGTGTTCCTCGACCTGGAGCCGACGGTGGTGGACGAGATCCGCACGGGGACGTAC CGCCAGCTTTTCCACCCCGAGCAGCTGATCTCCGGCAAGGAGGATGCGGCGAACAACTACGCTCGCGGCCACTACACGAT CGGCAAGGAGATCGTGGACCTGTGCCTTGACCGCATCCGCAAGCTTGCGGACAACTGCACGGGTCTGCAGGGCTTTCTTG TGTATCACGCCGTGGGCGGTGGCACGGGCTCTGGCCTTGGTGCGCTGCTGCTGGAACGCCTCTCTGTGGACTACGGAAAG AAGTCCAAACTGGGCTACACGGTGTACCCATCCCCACAGGTGTCAACGGCTGTGGTGGAGCCCTATAACTCGGTGCTCTC GACGCACTCACTGCTTGAACACACCGATGTTGCGGCGATGCTTGACAATGAAGCCATATATGATTTAACTCGTCGTAACC TCGATATTGAACGTCCAAACGTACACAAATTAAACCGGCCTCATCGGGCCAAGGTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CcruzaQ_678: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10709722107916AA426679TEUF0253T.cruzi epimastigote non-normalized cDNA Library
17854283293934AI046036TENU1072T. cruzi epimastigote normalized cDNA Library
17927133321049AI053170TENU1590T. cruzi epimastigote normalized cDNA Library
18047143340666AI065259TENU2146T. cruzi epimastigote normalized cDNA Library
18318333411367AI077059TENU3204T. cruzi epimastigote normalized cDNA Library


Date: 14:37:25 on Sun 19 Nov 117.