CcruzaQ_692


Sequence

>CcruzaQ_692 (2 EST) Length=483 GTTGTATGGAGAAGAATGCACGATGCAATCAATGTGTTTGCTCTTGTAATGTTCGGGCTCGGGACTGTAAGTAACGTATT GGTGTTTGGAATTAGAATCAACTCTTCAGCAATCCCTCTTTATAGAGGAAGTTGCATCGGAAAGAAAAAAGAAAAACCAA AAAAAGAAAAAGGAAAAAACAATCCATCCGTTGATATACCCAAACATTTGAGAAACCGGGGTATTAATTCCTTAGGCATC TGCAGGCTTCTGGCACTGTTGCAGTGCCTTAAGCAGCTCCACTACTCTATTCCCTTCCCTCTCCTCTTTATCCCTGGTAC CATCGCACTCGGGAAAAACAAATGCCATTTTATTCAAGAGCATCGCAACACGACTACGCTGCCTTTCGTTAATTCTGCAG GACTCAAGAAGGGTGTTTATTTCTTCGCTAGTTTCGAGCACCACTCGTGCAAGTTCATTCACCCTCGATCTCTCAGCATC TAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CcruzaQ_692: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16020312981518AA875688TENU0160T.cruzi epimastigote normalized cDNA Library
17828183290265AI043482TENU1042T. cruzi epimastigote normalized cDNA Library


Date: 13:29:49 on Fri 24 Nov 117.