CcruzaQ_695


Sequence

>CcruzaQ_695 (2 EST) Length=604 GTTTTCTGAATTAAGAGGTGCAAAAGGAGCCACGAGGAAAGGGATTCATTTGTGACACCGTTTTTTAGTTGTTTTTGTTT GATTTACCACTCATTTGGAGAAAAAAAAACACATACACAGGGAGAGAGTGCGGGAGGGAAATATCATCACAGTAGTAACG CATGGCAACGCTTTCGCAGGCTCGCCTTTCCGGGTGGGCGTCACGTTGGCTAACAGATGAACTTGTTGCGCTGTCCAAGG CGGGCAATTGGGAATCTGCTATGGCCACATTGGCACAACTGCAGCAAGCAAACATAGTGCAGAGCAATGTGTTTCACTAT ACCACTGTTATTAGTGCTTGTGGTCGGTCAGGAAAGTGGGAAGCGGCGATGTCCGTCTTTACACATATGGTGAAGAACGA TGTGAAACCCCAATTGTTTATACCTTACACAGCTCTTATTAGCGCATGTGCTGCGGCCCAGAAACCAGATTGTTGCGCTC CGGATGTATGCTCACATGCGACTCGCAGAGGTTCTTCCGAATGTGCGTACAATGACAGCGCTGGCGAATGCATGCTCCCG TGCTGGGCAATGGGAGCGAGCTATAAAAATTTTGCGGGAGTGTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CcruzaQ_695: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13816782655756AA676092TENF0624T.cruzi epimastigote normalized cDNA Library
17973943331809AI057943TENU2035T. cruzi epimastigote normalized cDNA Library


Date: 1:21:31 on Tue 21 Nov 117.