CcruzaQ_696


Sequence

>CcruzaQ_696 (2 EST) Length=484 CTTTAATGTCTTCTCCCCCTCTTTGTTGTCGTTTTATTATTGTTATTATTATTATTTTAGCTTTTCCTCCTTTGAAACAA AAAAAAAAAAAAAAAGAAATGACACTGACGTAAGGGAAAAGAAGAGGAAGAGGAGGAGGATTGAGTGAGTGAGTGGCGTA TATTATCCAAACGACCTTTTTTTCGGTTTTGTTTTTTGTTTTTGTGTTGTTCCTGCCGTTGCCGTTGCCGTTGTCGAGGT CCGCCTCATTTGGCAATTCTGCAAAATGTCCCGACAGCAACACGCCACACCGCAATTCACCTCCTCTCCCCCTTTTTCTC CCTCAGTGTGCACATACACACATTTATACACGTATATAAAAGTCAATACGATGGGCATATTGGAGGAGACGTCATGCAAA TGTGCCCAAATCTTCCCAGTGGGCACACACAGGAGGGAGAGAGCAACCGATGTGAGGATTAATGCCTTCCTTTCCCACCC AAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CcruzaQ_696: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13816052655683AA676019TENF0533T.cruzi epimastigote normalized cDNA Library
13817002655778AA676114TENF0661T.cruzi epimastigote normalized cDNA Library


Date: 15:8:31 on Wed 22 Nov 117.