CcruzaQ_706


Sequence

>CcruzaQ_706 (2 EST) Length=577 TCCCATTGTTTCTTTCTTTTTTTTTTTTTTTCATCATTTCTGTTTTGAATTCCTTGTGTCTTGTATCTCGTTTGGCCTCA TCATTCTTTCTTTATTTTTTATTTATCCACTTTCCTTCTCTCTTTCTTCTTTATAGAGTTTTGTACCTTTTTTTTTGTTT TGTTTTTTGTTTTGTTTTCTGATCCCTGAAAGCGGACCATGTTTTTCTCTTAATTCATGTGTGTGTATGCATTCATGTGC GTGGGGATTTATTTGTGTGCGCTTTTTGCGGGATTAGGTGCGTGGGAGGGCTCGTGTCGGGGCGCGATCATTTCTTTCTC TCAAACGAACTGTCCGTAAGGACTCGTTTGCCAACAACAAAACGGGAAGAGGGAGGGAAACAAAACAACGAGGAAATATC CACCGGGGGTCCGCCAGGGGAGGGGGTACAAATGAGCAATGAGATGTGGGTAAGGCATAACATCACGTTGTTTTTTGTTT CTTCTTTTTCATTATTTTTATTTTTATTTTTTTTATTTTATTTTTTTTTTTTTTCTTGTTTGGTGCTGCTGCTGCTGCCT ACATCTTTTCCCTCTCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CcruzaQ_706: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18244903392728AI069753TENU2798T. cruzi epimastigote normalized cDNA Library
18302233404499AI075548TENU3125T. cruzi epimastigote normalized cDNA Library


Date: 20:53:8 on Sun 19 Nov 117.