CcruzaQ_722


Sequence

>CcruzaQ_722 (2 EST) Length=547 GGACGAAAATGAGCGACGGCGCACGTCGTTTGCACGATCCAGAACGCAGGTCGTTATAGAAAATGCTTCGAGTATTCTTT CGGAGAATAACAGCAGCAACGGGGCACATTTGAGAAACAACGTCTTTGACAGACTCTACACGCCCCCAAAAAATGCATTA AAAACGAATTCGCAAGCTACACCGCCCATTTCAGGAGGGAAGAAGGCTCCATTTAACGTTTACGTGTGAGTTTTCGCACT TTTCCGGATTTTTTTTATTTATTTTGATTGTTCTTTATTTTGTAAAATATTTTTTCTTCTCTGTGAGTTTTTCTGTGCAT GTGTGTGTGTCTGTGTGTCTTGGGGTAGGTGAATGCACATACCCTTAATATTGTGGCTCCCCGTGTGTGTGGAGGTGTAT GAGTGGGGTGTCAGGTGTGATTGGCTGCCACTGAAGAANGGGTGGGCATTTGTGCACCGTATCCATCGCTCTTGTGTTTT TATGCAAAGGCACACGTTTTCGTACGCCGGAAAAAGAGAAAGATCAAATAGGTGATTGGGGGGAATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CcruzaQ_722: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
14535002772489AA738528TENU0037T.cruzi epimastigote normalized cDNA Library
17972633331678AI057812TENU1903T. cruzi epimastigote normalized cDNA Library


Date: 0:54:27 on Wed 22 Nov 117.