CcruzaQ_739


Sequence

>CcruzaQ_739 (3 EST) Length=887 TAACGATGAGTGGGCGTACAGTTTTAAAGGCGGCTGCGCAGTCTACGATCCCATTTTTGTTTCTTCCTTCGCTCTTCTTC TTCTTCCTCCTCTTCCTTTTTTTTTTTTTTTGAAAATTTGTATGGATGCCACGACCCTGGACATTCCGCCTCATAGCTGG GAGCTGCATTTACCTGATGAAGTCTGAATAAGGAGGAGGGAGAGATGCATAGAGGGCACTGAGGAATTTTTCCTAGGCCT TTCTTTCTTTCTTTTCTTTTTCTCTCTTTTCTTCTTCTTCTTTTTTTTTTTTTCTCTAACATGTGGAAACCATAAAAACC TTTTGTACAGTTTCTGNACTATATTGGTCTCTCCCTGTCCATGTGTCTTATCACCGTCTCATCCAAGGATGTCTCTTGAA GAAGGGCGGCGTTCTTTTTGTGCTTATTTGAATTTCCGGGGGATCTTTAGACGTGCACTCACGCAGATTGAGAACATAGA AAAAAAAAAACAAAAACAAAACAAAAAACAAACAATGATCGCATCTCACGAAAAGTAAACATGCAGTGATGCTTCATTGA TGGCGTACTGTGACCTTTTGTAATATTACTCGAGGCTCTGCTGTGGTATTGCATCCCTATTTCCGACGATCCGAAAGCGT ACATGATTAACACCGGGGTGGGATGGTGAGGATTGTTTTGGGAACGTGTGTCTTCATCTCTTTCTTTCTTTTTTTTTTTT TCTCTTCTCCCCTCATTTTTTGTCCAGTGAAGGGTGGCTTTCCGCTTCTCTTCGTTTTTTCCGTTGAAGATTTTATTTTT TGGGCGGAATGGTCTTTTTTTTTTTTTTTGTGTGTGTGTGTCTGTGTTTTGTGGGGGCGTTGTTCGCCGTGCGCTTCCAC TCGACAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CcruzaQ_739: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10860672153651AA441773TEUF0080T.cruzi epimastigote non-normalized cDNA Library
17854373293943AI046045TENU1081T. cruzi epimastigote normalized cDNA Library
18243483392586AI069611TENU2672T. cruzi epimastigote normalized cDNA Library


Date: 19:52:44 on Fri 17 Nov 117.