CcruzaQ_742


Sequence

>CcruzaQ_742 (2 EST) Length=591 AATCGGCACGAGGAGCGAATACCCTGATCTGTTCTGCAATCAGTTTGACGTCTATGATTTCTGCACGTACNACCGTCTGT CTCTGGGGCGCTGTAAAATGAAAAGGCACGAGGAAGCGCTGCCAGAGGAGTATCGGTACTTCGCTGATCCCCGAGTTGGC GGTGATGACCCCTGCATGAGCAGATGCCCGTATGTCGAGGGCGTATTCTAATACTGGGTGCACCAACGGCGATCCTTCCC TAATGCCTGGCAGTGTCGTTGGCCCGAACTCGCGGTGCGTGAAGGGGCAGGAACTTCAATTCGACGACGAATATATTGGC GATGTGTGCGTGGACACTCGATGCGGCGACGGCACACTGAGCGTGCGGTTCCTTGATGACAATGCGTGGCACGAAGTGCC AGGAAGGTGAAACCGTCACGCCCCCATCCGGTCCCGTGGCGTGGGAACATTGTTGTGCCCCCCAATACCCCAATGTGTGC ACCGCCTTCCCGAACATCAGCGGCTACCCAATACCGGTCGTTGACCCGCCTCTAGTGGACGACCCGACATCCGCGGAGGG TGCGGAGGGAGACGGGGGTGAGGTTCCGAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CcruzaQ_742: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16970553127227AA960729TENS1942T. cruzi epimastigote normalized cDNA Library
18415213421564AI083141TENU3818T. cruzi epimastigote normalized cDNA Library


Date: 4:25:22 on Thu 23 Nov 117.