CcruzaQ_743


Sequence

>CcruzaQ_743 (2 EST) Length=476 AGCCGTGTGAAGTTGCTGGCGCTTGCCGATCCGTGGGGCGTGAACGCGCCGACCCCAGACGCATAGAGCTTGCGCCTGTG CATCATCGGCTTGCATTGAAGATCTTCTACGCGGTCAACCCCTTGTCTTTGCTTCGCGCTGCGGGGCCTGTGGAACCGAA GCTGTTTAAATCTCTGCGCCCGGACTTTGCGAACCGATGGCGGAGTTTCTTGGCGAGCCCCCAAGTCTTCTACGAGTACA CGTATCACTGTAACGCGCAACTCCCTCCGCTTGGAGAGATGCTTTTCAAGGCGTGCTGTCACGCGAATGTTGCTGCCAAA ACGCCTCTTGTGGGGGTGCTGCCAGGGGGTTTGTCGAAGGCGATCCCGCTGGTGGTGTTGTACGGCAGCCATACGTGGAT GAACGCTGAGTGCGGATTTACGATGGTTGAAAAGATGGCTGAGGACGGGTACAAGGCGAAGGCGGACACAGTCATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CcruzaQ_743: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17972423331657AI057791TENU1882T. cruzi epimastigote normalized cDNA Library
18336583415172AI078996TENU3618T. cruzi epimastigote normalized cDNA Library


Date: 19:4:2 on Thu 23 Nov 117.