CcruzaQ_756


Sequence

>CcruzaQ_756 (2 EST) Length=698 ACGAGGCATCATTGAAGGCAAAAAATAAAAAAATAAAAAAATAAAAATGGACTTTCTTGACGAAGCCGTCATTTATCCTG TTACAGCGTTTATCCGCAACAGCCGCATGCTCGTACGTAAATGCCAGAAGCCGAACTACAGCGAGTTCACCACGGCGGCA ATGGCGACGCTGATGGGATTTGTCATCATGGGATTTCTAGGATTTTTTGTCAAGGTCATTTTCATTCCAATCAACAACGT CATCTTGGGAGCATAAACCGCAAGNAAGTACATGACATGGAAGGNGGAAGGAGAGGGGCATAAGTTACCCAAGACATGAT GTCCATATATATATATATACAAACACGGAAAGAATACACGTAATGTACATGTATATATAACATTTATGAAGAAGATAAAA GGGACCCATATATATATATATATGTGTAGGAAGGGGGGATGCTTGCGTGTGTGTGGATAGAATGGGATGTTTTGGTCCGA AATATTTAATTAACTGTGCGTGAGGACAGACGCATCTCCTGCATGAACTTTACCCTTCTCCCCCTTTTTCCCTCTCTTCA TACATCTCTTCTGCACTACTTTCATAATCTATTTATCTATTTATCTATATATATATATATATATATAACTGTGCTTTACA CTGATACTTTGTGTTTTTGTTTGTGTTTGTGTTTTTTCTTAAATTTAATTTTTACTCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CcruzaQ_756: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11768372275773AA532141TENF0231T.cruzi epimastigote normalized cDNA Library
17442473215188AI005678TENU0310T.cruzi epimastigote normalized cDNA Library


Date: 3:49:10 on Sun 19 Nov 117.