CcruzaQ_769


Sequence

>CcruzaQ_769 (2 EST) Length=510 AAAGGCTGTGTAATGAGACGAGGCATGTCAGCTGTGGTATCGCAGGCACCGAAAGAAGACCTCACGTTAAATTTGAAACG GAGGCCTCTGTCGGCGCAGCAACTCCATCTTAAACGTCTCATACAGTGGAAAATACACAGCCATGTTCAATGTCACCCAC AGCACACGGGTGCACCCTCCACGGAAGAAAAAAAAAGCTCCACCAAGACGATATGTGTCCTTCACCACATCAAGTACAGT TGTGGACGCATTCGACGCGGTTGCCACAACAACACGTGTACGAATAGTGTCAAGCGGAACGGTTACAGTAGACGCTAGAA GACCACTAAATCCACCCGCAAGAAAAGTGCAGAGAAAATTATAAACATACCTAGAAAGACGCAGAGCCCCCTGCTGCAAG CTCCTTGTGAAGTTCATGCCTTAGCTACAAACTTTGAGTCCACGGACGAAAACTCTCATACGCAATCCATTGAGTAATAC TGTATGGAATATCGTGAACAAGNGTTTGTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CcruzaQ_769: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16097182991867AA882756TENS0331T. cruzi epimastigote normalized cDNA Library
18243363392574AI069599TENU2660T. cruzi epimastigote normalized cDNA Library


Date: 8:30:23 on Fri 24 Nov 117.