CcruzaQ_789


Sequence

>CcruzaQ_789 (2 EST) Length=469 TAAAATGCCGTACGTTGCGAACGGCAGGGTCGTTGACTCGAAGCCGTTTAGTCTCGTCGACTTTTTTCTCTCCATTCTGC GTCTCATGTGGCTGTTTTTTGCCACTCTTGTTTCCTCCGAGCCCGTCTCGCAACACGTGCAGGAGTACAGATCAACAACG CGAATTGTTCCTTTCGGTGGTGGTCGCAGCGTTGGTCACGCTCCGCGTGGGNCCCAACATTCACGGACTTCCAAAGGGCT CACTTACTGGCGGATGTGCCACTGGCTGACGTTAAGCAGCGTGCGAGTTGGATAACCGACACATCCACGCACCCACAGGG CACAGCCAACTATGCATGTTGTGGTGGATAGAAAGGACTAGCGAAGAAGCAGAAGTTTCCTTTTTTTTCTGCCTGTTTTT CTGTCTGGGGCTAAGAAAGGTGTTTGGGTTGGGTAACTCCTTGAACGTTGCCAAGGATGCATTCTTCAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CcruzaQ_789: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13815912655669AA676005TENF0519T.cruzi epimastigote normalized cDNA Library
13815992655677AA676013TENF0527T.cruzi epimastigote normalized cDNA Library


Date: 6:3:14 on Sun 19 Nov 117.