CcruzaQ_796


Sequence

>CcruzaQ_796 (2 EST) Length=468 CGAAAGAACAGCAAATGATTTGCAAGAAGCACCCTCTCGGCCACGTACTAGAGCTGTTGAGGCTGCTACGCACCTCCCGT CTGTGATTCATCCTTCTCCAGAACCAACAGGTTTTGTATCAATCGCAACGTCTCTTTCTACCATCCCCTCACATACTTAT CAATGATGCTAAGAGAAGAAGTAAGAGTGTCTACTCATTGCTAACCGCCGACGAATTCTGCGAATGATGGAAATACAGGG TTTGAACGACGAGAATGGTGCTGCATTACCTGATTTTTTTTTTTTGTGGCAAAGTAATTCTGCACACGCGTATGTACATA ACGTTGCAACTATTTGAAACGGAGGAAAAGAAGACTTATATATATATTTATATGTATTTCATATAAAAACCGAAATATCA ACCTTGAGCGTGTTTTTCTTTTTTCCATTCATTTTATTTTATTTTTTTTTGTTTTTCGGTACAGGCGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CcruzaQ_796: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18387503417162AI080910TENU3768T. cruzi epimastigote normalized cDNA Library
18687413482748AI110328TENU3298T. cruzi epimastigote normalized cDNA Library


Date: 11:42:46 on Fri 24 Nov 117.