CcruzaQ_80


Sequence

>CcruzaQ_80 (3 EST) Length=573 TAATATTCCGGTAATAATATTGATAACAATAATAATGGCAATAGTAATAATAATAAAATAATGGTGATAATATTATTGTT ATTATTAATAGTAATAATAATAATAATAATAATAAAATAACAATAATAATAATAATAATATTAAAAATAATATTAATGAA GAAGAATAATAATAATAACTCCGAAAATAACAAACAAAACGTCAGAAAATCACTTGCATTCGCGTATCTCTCGGGGGATA GTTTCAATAGTTGTTTCCTAACAGTCAATTACATTTTCGTGCGTGCATAAACCTATTTCCTCGGAATTTCATTGGGCATA TATATCAATCGGGCTGTGTGAGANAAGGATGAGAAAGAAGATCCTTGCTTCTTGGACGCTTCTTGTGATCAAGAGTCAGA CAGGCCTCTACAAATGAAATAAAAGACTCATCAGTGACGTTATGAGCCGCAAGCTTTTGTCGAAGAACACTATAAGGACC TTCATTGGGAAGTGATCCCCTGGTATCTCCCAAATCAGCAATGTCATCTCTTNNTTTCTCTATATCCTGCTCATACACAC TTTGGGATTCCCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CcruzaQ_80: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6676661536847D87221D87221Trypanosoma cruzi Y (Tomoo Tanaka)
6676681536849D87223D87223Trypanosoma cruzi Y (Tomoo Tanaka)
6786981542838D87319D87319Trypanosoma cruzi Y (Tomoo Tanaka)


Date: 1:16:41 on Mon 20 Nov 117.