CcruzaQ_800


Sequence

>CcruzaQ_800 (2 EST) Length=722 CCACAAGACGATCATTGATGATCTCATGGGGCAACACGATGAGGAGCGAACGACACAAAACGATGTCATACGGAAGTTGC AGGCGGCACTCGATGAACTGCGGTATCGTTATGAGTACCGCGAGTCAAGAGAAGAAGATGTCGCGATGATTAACCGTCTT ATGAGGGAAATAAAGCAGAAGGATCAGGCGCTGGAAAAAGCGATACACGATATAAAGATGTATAAACTGGAGCTTATCAA TCGCGAGGAGAATTATAACAAGGTCTTTGGACGACGGCCGCTTGTCGAGCCCGGCTCTCCAGCTGACAAGGCACCGCGGC TGCAGCAGGGGATGCGAGAAAACCGAGATCGACCAGAAAGGCGAGCAACGCAGCAGTAACAAATCTCTGTTTAAAAATTG ATTCAAGCACCTACGCGTCATATTTATCAAGACATTTGGACCTCTTTTTTTTTTTTTTTCTTTCGTACTTGTGTGTTCTA TAATTTTCCTGCTTTTCTTTTTCTTTTTTTTGTTTATTTTATCGGTCGGTTTTTTTTTTTTTCGCCCCTCCGCTTACCCT TCGGTTGNCTTTTAGTTTTGTTTCTTTTGTTTTTGTCCGTTCCGCGACGGGGGTTATGGTTCTCTTCGCCTTTTCTCCGC CCAGTTGCGTGTCGTCGGGCCTCTTTCCTCCCTGCTGCCGTGCAGCTGGGCAAACACGAGGACTCAATGCGACTGCGGTG CC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CcruzaQ_800: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18046263340578AI065171TENU2051T. cruzi epimastigote normalized cDNA Library
18058123366469AI066304TENU2420T. cruzi epimastigote normalized cDNA Library


Date: 11:53:20 on Fri 24 Nov 117.