CcruzaQ_803


Sequence

>CcruzaQ_803 (2 EST) Length=467 GGGAGCGGCTTGTGACGGAGCATCAGCAGCGGGAGGGAGANGTTTGATTCCCTCCATCACTTGGTGGAATCACTCGCCGA TGAGTTGGCTCGACTGTCGGATATAGTGGCGGCGACCCGCACAGGGAACAGCCAGCTGTCGTCGCATGTCGAGCAGGAGT TAGAGCGGCACCGGTCGTGGTTGAAACGGCATAAGAGAGAAGAGTCTGAATTTTTAAATCTTTTTGAAGAGACATGTACG CAACTGCAGGATGCACTTCGTCATGAGCGGCGGGCACCCGAGGAAAGCATGAACCGCATTGAGAAGTTGTTGACGCGCCG TGGTGTTGATTCTGCCACCGCCCCCGTCTCGAACTTCCACCGATTTTAGATGCTGTAGAGTAGATGGTTTTACCGTGAAG AGTGTTACTTTCAATTGCTTTTCTCCTGCTGCTGCTGCTGCTACTGACAGTGGCAGTGGGAGTGTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CcruzaQ_803: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17926833321019AI053392TENU1557T. cruzi epimastigote normalized cDNA Library
18243813392619AI069644TENU2688T. cruzi epimastigote normalized cDNA Library


Date: 1:43:3 on Sun 19 Nov 117.