CcruzaQ_807


Sequence

>CcruzaQ_807 (2 EST) Length=467 TAAGTTTCGCAATTTCCTTTACGTCTCAACTCTGCTAAACAGTGAAATAATGGAGAAGTTATTGTTGTTGCTGCTGTTTG TTTTTTTTTTTTTTGTTTTTTTTTTCTTTTCTTCCTCTTCTTCTTCTTGTTGTTGTTGTTGTTTTATTCTGTGTTAATCT CCCAGATGAAGAAAGAAGGCTTCTAGCAAAAAGAAAAAAACAACCCCTCATCCGTGGGTGCGGCATGCTTTCGTGCGGGT GTGTCTCTCTTCCCCCGTATCCCGCCGCATGTGTGCGCACATACGGAATTCACTGAGTCGTGCACATCTCTGCAAACATG CCGTTCCTCTGCTTCTCTTATTTCCTTGTGGACACATGTAGAGATGTGTGTCCCAAGCCCTCCCCCTCCCTTTCTTCCTT TAATTATCCCGCTCACTGTCTTACCTCCTCACTTTTTTTTTTTTTTCTGTCTCCCACTTTCTTTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CcruzaQ_807: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17610443237451AI021838TENU0525T. cruzi epimastigote normalized cDNA Library
18046693340621AI065214TENU2097T. cruzi epimastigote normalized cDNA Library


Date: 18:3:59 on Fri 17 Nov 117.