CcruzaQ_811


Sequence

>CcruzaQ_811 (2 EST) Length=651 GTGTAAAACGTTCATATCTATTTACACACATCAGTATTGACGTAAAAGATTTTTTCACACGCAATATAAAAAGAAGAAGA AAACAAAGAGACATCGGCCAATAACTTTCATGATCCACAACTCGTTCTTCCTCCCGCCAGAGAAAACAACAACAACAACA ACAAAGGGCCGCTGCGCAAGTACAAACACAGGAACGCCTTTGTGCATATCAAACTACAGGAAGGAAGGACAACTTCCCCG TACAGGAGACGCGCCGCAATGGCCATTCGCCTCCTCTTGGAGCCGGTCAAGCAGCCGCAGCAAAAGGGGTAAATACGTGC TCTTAAACGCGGACGCAGTTCAGGTGCCGATGTCCGGAGAGGAAGAGCGTGCGGCACATCGCCAGAGTCTCATCCTCCAG TCTTCTGCGAAATGTCTCCTCCAGCGCCGTCTTGGTGCTCATCAGAGCACAAACCTTCTCTTCATCGCTTGTCCCGAGCC GTGTCGCTGAAGCCACTGCCGCCTTCAAACCGTCACGGTACGCACGTAGCGCCTGCTGCAGCTGCGCTCGGTATGGTTTT TGTAAACAACAAGAGGCGTGTATACTCCTCCGCCGCAAGGGGTGCCATGATGGTGGGCAAAACCACAACCTCATCCACCA GCTCCCCAGCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CcruzaQ_811: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17896283299295AI050178TENU1425T. cruzi epimastigote normalized cDNA Library
18048043340756AI065349TENU2236T. cruzi epimastigote normalized cDNA Library


Date: 9:58:31 on Fri 24 Nov 117.