CcruzaQ_814


Sequence

>CcruzaQ_814 (2 EST) Length=469 TGTACTATATTGAGAGACGGTACGGGAGATAAATAAACAAAAAAGCATTTACGAGAAATACGAATTTGTTGAAAAATTTG TCGTCATGACTGCGTTTCTTGATAACAAGCTGGAGTATCTCCAGAAACATAACATTGCACAACTCACGGAGCACATTGTG AGGAATATTATGGAGGATCTTCCGGAAAATCCAATCAAGTACGTCCATGACCTTCTGGAACGACCCATTCCCCCTCAGAT CGTCATTGCGGGTCCACCTGGAAGTGGTAAAGGAACGCAGTGCCANAGCCATTTGTAGAACGTTTTGGGGTTGTGCACAT CTCCTCCGGAGATCTGCTGCGTGCAGAGGTGGCGGCCGGTACAGAAGTTGGCAAAATGGCCGGATCTTTCATTCACAACG GGTGAAGATGGTTCCCAACAAAATTGGTTATCAACGCTGTTCCGCAAGCGGCTGGAGCCAAGACGATGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CcruzaQ_814: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12064992327578AA556126TENF0459T.cruzi epimastigote normalized cDNA Library
13815562655634AA675970TENF0458T.cruzi epimastigote normalized cDNA Library


Date: 12:22:36 on Fri 17 Nov 117.