CcruzaQ_820


Sequence

>CcruzaQ_820 (2 EST) Length=466 TGGCACGTTTATTTATTTTTCTTTCTTTGGTTCTTCCCCCTGTCTCCCTCTCGTTGTGTCATTAAACCACTGCCGGCTCA TGTCTGTTACAGTGCCGTGGGTGTTTTATTTACTGTATTTCTTCGTCTTCGTCTTTCCCTTTTTTCTTTTTCCTTTATAT ATACTTTTCTCGCAAATATTCGTTTTCCCACCCCACGCCATGCACCGGCAGACGCGCACACGCATGTCCCAACGGACGCG CATGCATGCATGGATGCATTTATGTATGTCTGTGCGCATGTAACTACGGGGGGAAACGAGAATCGTTGTCGCTCCACTGG GATTAGAGAGAAGGGGGACAACAAAAAAGAATGCACTACAAGAAATAACGATCGGCATGCACACATACAAAAAATAAAAA TAATAAATAAATAAATAAATAATCAACTTGATATATCGGTTCATCGCAAGCAACACGAAAAGACAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CcruzaQ_820: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18319023411436AI077128TENU3276T. cruzi epimastigote normalized cDNA Library
18688303482837AI110301TENU3973T. cruzi epimastigote normalized cDNA Library


Date: 20:37:32 on Thu 23 Nov 117.