CcruzaQ_821


Sequence

>CcruzaQ_821 (2 EST) Length=466 GGAGAAGGTCATCATGATGCGGTCTGGGTACTCCTCGCGCACTTNCGAGATGAGCAGAGTTCCCATGCCAGAACCCGTAC CACCGCCAAGAGAGTGGCAGATCTGGAAGCCCTGCAGGCAGTCGCAGCTCTCCGCCTCCTTGCGGCAAACGTCCAGCACG GAATCAATCAGCTCTGCGCCCTCCGTGTAGTGGCCCTTGGCCCAGTTGTTGCCTGCGCCAGACTGACCAAAGATGAAGTT GTCCGGGCGGAAGATCTGCCCGTATGGACCAGCGCGCACGGAGTCCATCGTGCCGGGCTCCAGGTCGATAAGCACCGCAC GGGGCACGTAGCGGCCGAAAGCTTATTCCCTTTAGTGAGGGTTAATTTTAGCTTGGCACTGGGCCGTCGGTTTTACAAAC GTCGTGACTGGGGAAAANCCTGGGCGGTTAACCAACTTAATCGGCTTNGAAGAACATCCCCCTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CcruzaQ_821: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12064682327547AA556095TENF0378T.cruzi epimastigote normalized cDNA Library
13815492655627AA675963TENF0430T.cruzi epimastigote normalized cDNA Library


Date: 10:47:2 on Tue 21 Nov 117.