CcruzaQ_828


Sequence

>CcruzaQ_828 (2 EST) Length=464 TCGCGATGTGGAGCGCCTTCTCAATCGCATGCAGTCCGTCACCGGCACGAGTTTTCTCTCCACATCCGCTCGTGGATCAT GGGTGCCGGCGATGGACATTGTCGAGAGGGAGGACAGCTACAAGATTCTTGCTGACTTGCCCGGCATGAACCGCAACGAC GTCTCTGTGGAGATTGAGGGCAGCCAACTGTGCATTGGAGGCAACCGCAAGTCCATGCTGAGTGAAGAGGAACACAAAAA CGTTGTGATGGCAGAGCGCGGTTCCGGGAGATTTGAGCGCTGCGTGCGACTTCCCTCACCCCTTGAAGAGGGCAGCGTGA AGGCCAGCCTGCGTGATTCGGTGCTGCTCGTGGAGGTGAAGAAAGTGACGGACGCCGTGCGGAAGCGCTCGGGGATCTCC GTGAAGATCAATTAGCGTCCCATCGCCGCTGCATCCAAACCGCATTGATCTCGACAGCACTCAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CcruzaQ_828: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17973973331812AI057946TENU2038T. cruzi epimastigote normalized cDNA Library
18415103421553AI083130TENU3807T. cruzi epimastigote normalized cDNA Library


Date: 4:45:38 on Sat 25 Nov 117.