CcruzaQ_85


Sequence

>CcruzaQ_85 (2 EST) Length=566 GATGCTTTTTGACAAGTACACCTCCACCAAGGCGGTTGCGCAAACAAGACACTTGCCTCTCGCACAGCCGCAGATGAGGT GCGGGAGTACAATCGTGAGCGCGATCACCTTGAACGGAACCTTGCAGGGCTGAAGAACAAGGTGAACAAGGACGCGGAGA ACAATCGCACCGACAAGAATCGTATCACCACAGAGAACGTCATTCTCATCAGGGAGATCAACGACTTGCGCAAGGAGGCA CGACGGTTGGCTGAGAAAGCGGGCGCCTGGCGAAAGACGGAAAAGTGTGGCGCATCCTTGCAACAAGAGGAGACGAAACG CGAACTTGCGATGCAACGGGCGGAATTGAAGCGTCTGCGCGCCTTGGCGAGAAAACTGGCAGAAGAGGCACGTGAAAAAG GAATCACGTTAACGCTCCCTTCCTTGACTGAAAGTAGACCGGGGAGTTGAGTTGTCATCGATGTATTTTTATTTGTGGAT TGTGTTTTTTTCTTTCTTTTATTTTTTCCCCTTTGGTTGTTTCTCTCTTGTTTATGTGCGTGGACGTGGACGTGATTGTT CATTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CcruzaQ_85: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18243283392566AI069591TENU2651T. cruzi epimastigote normalized cDNA Library
18337123415226AI078954TENU3672T. cruzi epimastigote normalized cDNA Library


Date: 4:24:26 on Wed 22 Nov 117.