CcruzaQ_867


Sequence

>CcruzaQ_867 (2 EST) Length=669 ATAATATAGGGAGAGAAAGAGACAGAAAGAAAAAACAAAGGGAAAACATTGTTGTTGCTTTTTGGTGCTGTTTCGTTTCA CAAAAATTGCCTCTACCGTCATGTGCAGCACCTTCAATCACGACCCCAGTGAGTCCTCATCATCACTCTTTTTTACCACG GAAGACAATGGCAACCAAGAAATATCTGCCTGAGACGGTGAAGAAGAGTCCCCGTCGTCATTTCCGCTCATGGAGTCTTC AGGCAGGCTGCCATTTGCAAAGGAGTTGTGGATCATCGTTCTAAGAGCTGCCACGCGCAACGGGCCCGAGACGGTGAAGA AATTCATTCAACATGTTGTCGTGGCCAGGGGCTGAGCCAAGCAAAGAGTCACGGATGGTCACGTCAAGTTAATACGGCGT GAGAGGCCCGATCCATTTCCCAGCCACCAGGAACCAAAGAAGTGCAGCGAGCAGCAGCGAGCAGTATAGGGTAATGTGGC ACGTGGAACCGCAAAAAATGACGGACAATCAGATTTGCCTGTTGCCGAGGCAGGGGCATACGCGGCCAAGATNCATGCGG AGCACAACCGATTCCAGAGGATGAGGGTGCGGCGCCGCCATGCCGTGAAGATATCGNCAGCTCGGGCTGGGTGAGGCTCC ACATCTTTTCGCGCGGGCTTCCCTGTGGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CcruzaQ_867: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11767752275711AA532179TENF0286T.cruzi epimastigote normalized cDNA Library
18689473492584AI110469TENU4081T. cruzi epimastigote normalized cDNA Library


Date: 23:23:37 on Sun 19 Nov 117.