CcruzaQ_871


Sequence

>CcruzaQ_871 (3 EST) Length=698 TGTGAGCATCCCTACACACATATGTTCGGGCTGATATAACAGAAACAGAAAAGAATAAAAAACAACAATAAAATAAATGG CATGCGTCCCTCCCCAATGGTCTCCTTCCGGCGGATCACACCCCGCTGCTTTGCCGCCGCCAGAATTATAGTGGCGAAAC GCCGCAGAAAAGGTGCGAAAACAGGCACAATAAAGGAAATCCCCGAAGTCACCTCAAAAAGCCTCGACATGAAAAGCATC CAATAAAGAACACTATGCCTTCTGGGAATCGAGGTGCATTCCTGCTCTTGCTGATTACGAGCTTGAGGCGCATCCCTGCC TTGCTGCTTGCGAGCTTGAGGCGCATCCCTGCCTTGCTGCTTGCGAGCTTGAGGCGCATCCCTGCCTTGCTGCTTGCGAG CTTGAGGCTCGTTCCTGCCTTGCTGCCTGCGAGCTTGAGGCGCATCCCTGCCACCACGCTGCGTGCGACCGTGAGGCGCA TCCCTGCCACCACGCTGCGTGCGACCGCCCTCTTCCTTCCGGGTCGGCCGGGCGCCGTGCTGCTGCTTGTGACCTTTGAA TCAGCTGTGACCTTTGCTTCTGCGGCTGTGGCTGCAGCTTGCGGACGATGCCCTTCTGANCGCCGCNCACTGCGCGACAC CTCTCTGGGTTGGAAGGACACGAGCTCCNCTTTGTTGCAGAGCACCCCTTGGTAAGCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CcruzaQ_871: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10775902130773AA433296TEUF0112T.cruzi epimastigote non-normalized cDNA Library
15577012909889AA835603TENU0062T.cruzi epimastigote normalized cDNA Library
18048513340803AI065396TENU2284T. cruzi epimastigote normalized cDNA Library


Date: 15:58:3 on Fri 17 Nov 117.