CcruzaQ_872


Sequence

>CcruzaQ_872 (2 EST) Length=557 CCACACAAGTCGGAATGAATCGGGCGAGACGCCTTTATCTTCTTCAAACTACTGTAGGTCTCTGAACCAGCGTTTTCACC CCATCTCGGCGTAAGAGGCGGAATTCCACACAAAATGAGGGTGCCCCACGTGCGGCATTTGAGGCAGGAAGGACTATTGT TGCGCATTATGCGGTTTCACCACACATTCCCGGCGCAAGCAGCCGGAATTCCAGCAGCAAAATGAGGGTGCCCCACGTGC GGCAACTCAGGCAGGAACGGACAAAGGTTGCCCATTATGCGGTAAGGCTCTAGGAGAAGGCAATTACATCAGTCTTTGAA AGTAAAGTGTTTATACTGCGGCATTTGTGTGAGGCCAGCGTCCGTTTGGTTGTGCTGCCGAATACGAACGCGTTTTACTG CGTTTCAGTGTATGAATGGACCAGCGCACGCAAATCTGCGCGGAGAGGGGAGTAGAGGTATCCGGCTTTTGTTGATGCGG AGGCAATGGAATGCCGAAGGCGACGAGGATGCGGGGCCGAGGGACACAAGAAAGGGAAAAGGGGCCGCCCTGAGAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CcruzaQ_872: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17855463294052AI046154TENU1240T. cruzi epimastigote normalized cDNA Library
18057223366379AI066214TENU2329T. cruzi epimastigote normalized cDNA Library


Date: 9:6:32 on Sat 18 Nov 117.