CcruzaQ_88


Sequence

>CcruzaQ_88 (2 EST) Length=819 AGTCATTTCAGAAACACCGGCCATCTCATCTACCAGTTCAGCAAATGTGGCTTCATTTATTGGTCATTTGAATGATGGAG TGTCGTCTCATGATACGTTCGTGGGTAGTTCTAGCGGTGCTTCACGAGACACCACGATTTCGCACGCGTCACCAGCGATT CGCGGTAACTCCGCGTGTCCTTCAGGTCTACTTCCGTCTCTCGCCAATTCCTTGACCCAAACTACTAGGAGCAACGAAGT GAAGGGCGGCACACAACGAGGGAATTTTACTTTCATTCTTCTATTCATTCCCTGCAGCGCCCCACCTCTTCCGGTGACGA GGAGAATGTTGCGTTGCCGTTGCAGAAGGCGGCTGTGTTTACCAACATGGAGAACGACAGTGGCTGTGGAGACCCCAAGA AGACAAAAACAGGCCTGGAAGCGTTGAATTATTGCACCAACAACGCTGTACCACGAGGGGTGCCGATTCCACTTCTAAGA TCTTCAAGAACAGAGCGCACGAATTTAGGTACAGTCCCACTCCATCCCGTTGCTTCTGAGAAAAATCTTGTCACGCGCAG AGAGTGTGGCGGCGATTACGTTCGAGGACGTTACCGCGGGCCTTCTTCATTTGTTCCAGTCTCGGGGTTTACCGGCGTTG ATGATTCCTGAGGCCTGTGCAACCGAACCCCGGGAGGGGAGCAACTGAATTTCAGGTTGCAGGCAGAACAGGGACTAAAC ACGAGGAAGGCGAGGCGAAATTTACTCGAAATGTCTGGAGCGAGTTGATCCCAATTAATTATTTATTTGTTTTATTTTAT TTGGAGGTGAGGAAAGGAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CcruzaQ_88: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17657223244340AI026514TENU0726T. cruzi epimastigote normalized cDNA Library
18318243411358AI077281TENU3195T. cruzi epimastigote normalized cDNA Library


Date: 15:3:43 on Sun 19 Nov 117.