CcruzaQ_904


Sequence

>CcruzaQ_904 (2 EST) Length=454 TGATCCGGATGAAATGGATCGTCGCTATCAGGAGCTTTTGTCGGAGCTGACTTGTACGAATCCTGTTCTAGAACTAGACC TAAAAAAGAATTCCTCAAAGTTGCTGTATGATGCCCCGTCAGCAAACAGTTCCTCTAAGACCGCAAGAGGGAAAAACCCG TTTATGAGGGCACTCGTAACTCACCATCCTCAGAATTGACGGCAAACGCTCCAAAGATAGATCAACAGAAAGTAAGCGAA AAGGGTGTTTCATCGCAGCCATTGCCATCCCAAACTGGGGTTCAGGTCTTTGTTTTAAAGCAAGAGGAAAAAGGTGATTG TGGTCCCCTTGTAAAGCCTGATATCACTGTGGAGAAGGTGCAAGAGCCATCGCATGCCATTTCTCCTAAAGATGGATTAT CAAAAAAAACTCTGGCGGAGAAAAAGTGTCCGTCCATCACCTCGACCTCTTCTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CcruzaQ_904: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16189043017752AA890873TENS0723T. cruzi epimastigote normalized cDNA Library
18318853411419AI077111TENU3258T. cruzi epimastigote normalized cDNA Library


Date: 11:22:44 on Sun 19 Nov 117.