CcruzaQ_915


Sequence

>CcruzaQ_915 (2 EST) Length=465 GGCACGAGGGTTTCTGTACTATATTGGCTTATAAACTGGTCTGATTTTATCTCTCTCATGCTGCTGCAGGACGTTATTGG AGAGTTTTTGTCCCTGCCTCCCCGTGCCCTTCAATTGGAGCGTGTTAGCGAAAATATTTTTTGCAGCGTGTATTTGTGGA CACCCACTCACTCCAAAGCGACGTATGGGGGGCAGTTGGTGGCGCACTGTGTGGAGGCCGCGTATCGCGCGCTGGATGAC CCCCATACGGATATCATCAGTCTTCAGCTGAAATTTCTGTCAGCGGGGAGAAGTGATTGTGGATCACCCGTGGTGTACTC CGTGAAATCGTTACATAATGGCCGTTCTTTTTTTTCCCGGCTTGTGTTGGCAATGCAACAAGAACGACACATACTCTCTG CAATTATAACTTTTCCTCAACAAAAACGTGGCGGCCTTGAACATCAATTGTGTCTGCCAGGGTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CcruzaQ_915: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11703582267787AA525718TENF0110T.cruzi epimastigote normalized cDNA Library
18302403404516AI075565TENU3142T. cruzi epimastigote normalized cDNA Library


Date: 1:22:19 on Mon 20 Nov 117.