CcruzaQ_925


Sequence

>CcruzaQ_925 (3 EST) Length=642 CGTTGTTGTTGTAACGCAGCCAAAACTTGACTTTTTCTCTGTTTCTTTCTTTCTCTCTCTCTCTATCTCTGTGTGTATGT GGATGCGTCAGTGCACGACCTGCAATCAGATTACATGTAATAGATGGCAGTCGTTGCACAAACGCATAAACACAAACGCA CAAATAAACTTATCCAATGCCGCAACGTCGTTGTAGCGGAAAAAGCAAGGTGGTGTGTTCTTTGGGTGGGTAGGTAGTAA TCCAGGAAGCCATAGATGTGTCGATGTTGTTGTTGTTGTTGTTGTTTTGCGGATTTTACAAATATTTATTTGTTTTTAAA TTTGTGTGTTTGTAGTTGTGTGTGTGTGTGTGTGTGTTTTTTTTTCCTGTTGTGTGCCTTGACGACTTTTCTTTCCCGTT GATTTGTGTGTTTGTGTTTGTACCTTTTTGTGTGTTTTCCTAATTGCGTATTTGAGTGTTCTTCAATTCCCCCTCTTCCC TGTCTCTGTCCTTCGGCTGCGTGCCGGGGCCTGCGCGTTGTTATTTACNCGTTTGGGAGAATAGACCGATGATGATGATG ATGATTGTAAACAATTGTCTGAAATTTGGACTCGTTCTTCCCGTGTGTACTTGACGGTGCGGGAACGCCGAGCCACAGGA GG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CcruzaQ_925: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17854833293989AI046091TENU1177T. cruzi epimastigote normalized cDNA Library
18056403366297AI066132TENU2523T. cruzi epimastigote normalized cDNA Library
18302593404535AI075584TENU3006T. cruzi epimastigote normalized cDNA Library


Date: 11:50:0 on Fri 24 Nov 117.