CcruzaQ_935


Sequence

>CcruzaQ_935 (2 EST) Length=568 CGAGCCTCTTTCCTTCCCATTAATTTCACGGTTTGTTCCTTTTCGCCTGGNCCTTCCTGCTGAGAGGGGGGGGAAGTAGG GGTGGTGGTGGCAAANGACACACTGTGTCCTCTCCGCACACAAGCAGCGTGAGGAAACAACGCACATTTCACAAGTGTTT CCAATGCAGGGTAAATAAAACTGAGTGAAGGCAACGGCAGCTTTTTTTTTTTTTTTTTTTTTTTTTCGTTCCTCCCTCCA CTATCCTTCGTGCATCCTTCCTGTGGGCTGACGGTGCACGCAACCCACTCCTCACCAATGTATGCCTCTTCCTTCTCTTA CCATTGTTGCCACCCACCTACGCCCCATCCAAACAAACAACATGTGCATCCCCCGCAGGACACGCACATTAAACATTGAA CCACTCGGCACCGTAAAGAAAAGCTGCCGTTCTTTAAGCCCTAGTGTCCTCTTAAATAAAATTCCCTCCATCAATGAGTT CGTCTCATTAGCATCGTTGTCCCCATATTCATTTGTGATATCTGCACATGTGTCTGTACTCCGCCTTGTCGCTGCCCCCT CTCGCCCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CcruzaQ_935: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11767602275696AA532164TENF0265T.cruzi epimastigote normalized cDNA Library
15577082909896AA835610TENU0069T.cruzi epimastigote normalized cDNA Library


Date: 16:8:30 on Tue 21 Nov 117.