CcruzaQ_944


Sequence

>CcruzaQ_944 (2 EST) Length=582 GCTCGTGTCTTGTATTAGGCGGCAACTGACCGTCGTACTCGTCATCACATGATGCTTGGCGGCCAGATCAACCCTCGTGA GTGGATGAACTGGCATCCGAAGAGTACCAGCCGTGGTATTTTGATCGCCATAAGTTTCTTTATGAGCGGCAACAATACGC ACACTTTCACCACCTTCTTTGTCATCAGGTCTTTCTTAAAGATATGCTTCATTTGGTGCAGCACCCAGAACCTTATACGC ACATTGTCGATTGTAGGACTTCGCCGCTAAAGATGCATCGTTGGGTTCCTCACAGTTGGTGGCTAACAAGGCACGAGGAG TTGACTATGCTCTTCAACTTACCCCAGACGAGTTTGCTGACATGTATGGGTTTCATAAACCACGTAAGTCAAACAATGTT ATTCTTGTTTCCCACAACGGCCTTTACTCTGAACAGGCCGGTTGGGAATGGAANAAACAGTTTTACCANCACGTTTACAA TTACCGTGGCGGGACAAATGAACTGTTTGGGGAGCAATACAATGACGTAGCGTTGAAGGATTCTCTTCCGCCTTGGAAGG GGCCGTTTCCGCAAAGTGGTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CcruzaQ_944: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16888963115666AA952570TENS1754T. cruzi epimastigote normalized cDNA Library
18337343415248AI078901TENU3694T. cruzi epimastigote normalized cDNA Library


Date: 8:19:38 on Fri 24 Nov 117.