CcruzaQ_950


Sequence

>CcruzaQ_950 (2 EST) Length=497 TGACGGCAAAAGGTACGTGTCGACGAGGGCGACAACTGGATCTCCCTACAGGAACTGGATGGAGCGGTTTTACAACGACA CCATCACCGAGTCCCAATATCTTCAGGCAATCCCCGTGCTTCGTTTGGGTGAGCGCTGCACTGTCTTTTACGACAAGAAA AACCCAGGGGCGCACTCGGCCCTTGCCCACGACGCCAACTCATTTGAAATTTCAATTCTGAGCTTCTTTACCGTCGTCCC CCTACTCATGGGGTATCTTATGAAGGCACATTGGTGGATGCTCAAAAAGGCGTACATGCCGAACAAAAAAATGCGCGTTC GCTTTCCACCAACAGCCCGTCCGCCCCCTCCTCCGGAGCCGCCGAAAAATGTCTCGCAGATCTCTCCGCTTCCCAAGTCA TGAGTGACGAGAGGGAAGTAGGGAAGGAGGAAGAGAGGGAGATTTGAAAAAGGAAACGGTGGAGAGGGAAGAAAAGGCCC GGAAATGAAATGACACC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CcruzaQ_950: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17855943294100AI046202TENU1289T. cruzi epimastigote normalized cDNA Library
18320153411549AI077241TENU3466T. cruzi epimastigote normalized cDNA Library


Date: 6:11:43 on Fri 24 Nov 117.