CcruzaQ_961


Sequence

>CcruzaQ_961 (2 EST) Length=656 CAGCCCAGTGATGCCATCGNCTCCCACCGCCCGCGCANCCCGCACAACCGCCGTGCAGAGTGGCGGGACCCCGGCCAAGG NGCAAATGACCATTGGCACCGNCCTCCTCGCCAAATGCCTCCAACACATGACGACCCCGATGCCGTGGGCAACACACAAA AGCCGAGGCAGATACACGTGGCACTGTTACAACCGCCAGCCATCGAGCGCGTCCGTGAACGTGGTGGTGGTGGCGCGGAA GTGGGGTGGTGAGTGCGTCAGTTGCCAGTAGTCAAAGCGTCGTTTCTCGCTCACGTGGGTCGGCATTGCAGAACAAAGAG CGGCATCATGCGCACACGGCATGCACAAGGGCAAAAGGGACGAACAAAGAAGCACAGCGGCGGCACTCAGCCACGGGGGA CAAGGGTCCACATCGACTCTGCGGTCGGTTGACCTTCAGACGTCCGGTTTGTAATCACGCCGCCGCCGCGCAGTTCGTGT GTCTGCAGGAGACTGGGGAATGGAGGGAGGGAAGAGAGATGCGGTGCTGGCCCGCATCGATCTCAGTTGGGTGTGACAAC GGTGAGGTCATCTCGTCAGGTTGCCGGCAGTAAAGACGGTCGCCGTTAGCGGCGGTCAGTGCCTTCCTTCTCCCACCGCA GCGCCACTCCACCGAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, Processing,


Cluster Information for CcruzaQ_961: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16063312988509AA879399TENU0265T.cruzi epimastigote normalized cDNA Library
18057853366442AI066277TENU2393T. cruzi epimastigote normalized cDNA Library


Date: 17:52:21 on Tue 21 Nov 117.