CcruzaQ_969


Sequence

>CcruzaQ_969 (2 EST) Length=449 TAATAATAATAATAATTTCGCCTTACCGTTATCGGTTCCCCGATGCCCTAAATCGCGGCCATCCAAAGGCTCATAAAATA GAAAAGAATCGGAAAAAGATGCGCTCGTTTTATCCGAATATATTAATTTGGGTAACCAGCCTTCCTCGCGCACACCATTT GCACAAGCTCCCACAGAATCAAAAAACCCTAGTCCCATTGCTCCAGTTTCTTTAGATATGCTAAAAAACAAAAGAAAAAA AAAACACATGGATTTAAATAAATTACTCCACGCACTTATGAAGCACGGCAGGAGACACGTGCTTCGGTCCTTCCCCACAT TCCCATCTCTAGTACCCACGCACCGGGTCCACAAGGTAGGTATCGAGCCGCTTCGTCTTTGCGTACTCATTGACCAGGCC AATGAAACGGCGAACAGAATCAGGGACCAAATTGGCTGTCCTGTCAGCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CcruzaQ_969: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16100832992644AA883045TENU0303T.cruzi epimastigote normalized cDNA Library
17442603215201AI005691TENU0323T.cruzi epimastigote normalized cDNA Library


Date: 19:21:51 on Wed 22 Nov 117.