CcruzaQ_996


Sequence

>CcruzaQ_996 (2 EST) Length=480 CCTCTGCGATGGCACTGGAGCGACGGAATGCCCGACTCGGCCTTCTGCTTCTTCTGCAAAGGGAGGGGACGGTGTGCGGC GTGCCTCGCTGTGTGTGCAGGGCACCATCCATTGCAGCCTGCTGTGCGGCATGAAGCCAATCCGTGAGACAGAGTCGTGG CCGACTATGCCGTGGGCTTGGGTGCGCCCCGTTCTTCTTGTTGCGGCTGCCTGTGTGCTAGTCCGCACGAGCAGTTTCTT GCGGAGCAGCGTGGATGACGCTGCTTCTGCGTGCGTTGTGCGGCTGACCTCCTTCTCCACGTTTCTTCACCCTCGCACGA GGGGGCGTCGTCCGTCACCCGCCCGTGCTGGAGGCTGCCATTCTCAGTACTCCTGCATGACCACTGTGCTGCTTGCGGTC AATACGTACTGCATGGCTCTGTGGTACGTGGAGGACCACCACTGGCAGGAGCTGCGCGAGCCGCGGCGTGGAGGGCTGGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CcruzaQ_996: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16887713115541AA952445TENS1383T. cruzi epimastigote normalized cDNA Library
17971003331515AI057649TENU1739T. cruzi epimastigote normalized cDNA Library


Date: 20:37:50 on Thu 23 Nov 117.